Review




Structured Review

Genechem ovol2 plasmid
Ovol2 Plasmid, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ovol2+plasmid/10__2147_slash_ott__s157119-50-18-22?v=Genechem
Average 90 stars, based on 1 article reviews
ovol2 plasmid - by Bioz Stars, 2026-07
90/100 stars

Images



Similar Products

91
Addgene inc position ul39 test acgactttgggcttctcaac ccttgtttgtggtggcctgg jn555585
Position Ul39 Test Acgactttgggcttctcaac Ccttgtttgtggtggcctgg Jn555585, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ovol2+plasmid/pmc10588894__pone__0286231__s003-0-159-139?v=Addgene+inc
Average 91 stars, based on 1 article reviews
position ul39 test acgactttgggcttctcaac ccttgtttgtggtggcctgg jn555585 - by Bioz Stars, 2026-07
91/100 stars
  Buy from Supplier

90
Addgene inc ha ovol2 ovol2
( A ) mCardinal fluorescence of the dim-VRCs population transfected with active SNAI1 or proTGFβ plasmids. The fluorescence of the cells was measured after 24 h (control – filled circles, proTGFβ – filled squares, active SNAI1 – filled triangles) and 48 h (control – filled inverted triangles, proTGFβ – filled rhomboids, active SNAI1 – circles) of culture after sorting. The points correspond to the fluorescence of a selected ROI, whereas the lines show mean fluorescence. The fluorescence changes were considered statistically significant in comparison to the control group: * p ≤ 0.05 (Mann–Whitney test). ( B ) mCardinal and ( C ) VIM relative quantification (RQ) by qPCR. VIM and mCardinal genes were measured in transfected dim-VRCs 24 (proTGFβ – filled inverted triangles, active SNAI1 – filled squares) or 48 h (proTGFβ – filled rhomboids, active SNAI1 – filled circles) after transfection. dim-VRCs represented as circles, bright-VRCs represented as filled triangles. The data shows mean 2 –ΔΔCT relative to GAPDH. The results were normalized to the control, which was pUC18-transfected dim-VRCs. The graph shows the representative result of the measurement, which was performed in triplicate. ( D ) Relative quantification of CDH1 by qPCR. CDH1 levels were measured in proTGFβ transfected dim-VRCs 24 (proTGFβ – filled inverted triangles) or 48 h (proTGFβ – filled rhomboids) after transfection. The graph shows mean RQ 2 –ΔΔCT ± SEM relative to GAPDH. The results were normalized to the control, which was pUC18-transfected dim-VRCs 48 h after transfection. The graph shows the representative result of the measurement, which was performed in triplicate. dim-VRCs represented as circles, bright-VRCs represented as filled triangles. ( E ) Immunostaining of E-cadherin and ( F ) mCardinal fluorescence in VRCs and HT29 E-cadherin positive cells by flow cytometry. VRCs control—VRCs transfected with pUC18 vector; VRCs <t>OVOL2—OVOL2-overexpressing</t> cells 24 h after transfection. Immunostained untransfected HT29 cells were used as controls. The graph shows the single reads as well as the mean value of three independent experiments. Statistical significance in comparison to control group is represented by asterisks: * p ≤ 0.05; ** p ≤ 0.01; *** p ≤ 0.001. VRCs control represented as filled circles, VRCs OVOL2 represented as filled triangles, HT29 represented as filled inverted triangles.
Ha Ovol2 Ovol2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ovol2+plasmid/pmc06953058-35-44-22?v=Addgene+inc
Average 90 stars, based on 1 article reviews
ha ovol2 ovol2 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Genechem ovol2 plasmid
( A ) mCardinal fluorescence of the dim-VRCs population transfected with active SNAI1 or proTGFβ plasmids. The fluorescence of the cells was measured after 24 h (control – filled circles, proTGFβ – filled squares, active SNAI1 – filled triangles) and 48 h (control – filled inverted triangles, proTGFβ – filled rhomboids, active SNAI1 – circles) of culture after sorting. The points correspond to the fluorescence of a selected ROI, whereas the lines show mean fluorescence. The fluorescence changes were considered statistically significant in comparison to the control group: * p ≤ 0.05 (Mann–Whitney test). ( B ) mCardinal and ( C ) VIM relative quantification (RQ) by qPCR. VIM and mCardinal genes were measured in transfected dim-VRCs 24 (proTGFβ – filled inverted triangles, active SNAI1 – filled squares) or 48 h (proTGFβ – filled rhomboids, active SNAI1 – filled circles) after transfection. dim-VRCs represented as circles, bright-VRCs represented as filled triangles. The data shows mean 2 –ΔΔCT relative to GAPDH. The results were normalized to the control, which was pUC18-transfected dim-VRCs. The graph shows the representative result of the measurement, which was performed in triplicate. ( D ) Relative quantification of CDH1 by qPCR. CDH1 levels were measured in proTGFβ transfected dim-VRCs 24 (proTGFβ – filled inverted triangles) or 48 h (proTGFβ – filled rhomboids) after transfection. The graph shows mean RQ 2 –ΔΔCT ± SEM relative to GAPDH. The results were normalized to the control, which was pUC18-transfected dim-VRCs 48 h after transfection. The graph shows the representative result of the measurement, which was performed in triplicate. dim-VRCs represented as circles, bright-VRCs represented as filled triangles. ( E ) Immunostaining of E-cadherin and ( F ) mCardinal fluorescence in VRCs and HT29 E-cadherin positive cells by flow cytometry. VRCs control—VRCs transfected with pUC18 vector; VRCs <t>OVOL2—OVOL2-overexpressing</t> cells 24 h after transfection. Immunostained untransfected HT29 cells were used as controls. The graph shows the single reads as well as the mean value of three independent experiments. Statistical significance in comparison to control group is represented by asterisks: * p ≤ 0.05; ** p ≤ 0.01; *** p ≤ 0.001. VRCs control represented as filled circles, VRCs OVOL2 represented as filled triangles, HT29 represented as filled inverted triangles.
Ovol2 Plasmid, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ovol2+plasmid/10__2147_slash_ott__s157119-50-18-22?v=Genechem
Average 90 stars, based on 1 article reviews
ovol2 plasmid - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

Image Search Results


( A ) mCardinal fluorescence of the dim-VRCs population transfected with active SNAI1 or proTGFβ plasmids. The fluorescence of the cells was measured after 24 h (control – filled circles, proTGFβ – filled squares, active SNAI1 – filled triangles) and 48 h (control – filled inverted triangles, proTGFβ – filled rhomboids, active SNAI1 – circles) of culture after sorting. The points correspond to the fluorescence of a selected ROI, whereas the lines show mean fluorescence. The fluorescence changes were considered statistically significant in comparison to the control group: * p ≤ 0.05 (Mann–Whitney test). ( B ) mCardinal and ( C ) VIM relative quantification (RQ) by qPCR. VIM and mCardinal genes were measured in transfected dim-VRCs 24 (proTGFβ – filled inverted triangles, active SNAI1 – filled squares) or 48 h (proTGFβ – filled rhomboids, active SNAI1 – filled circles) after transfection. dim-VRCs represented as circles, bright-VRCs represented as filled triangles. The data shows mean 2 –ΔΔCT relative to GAPDH. The results were normalized to the control, which was pUC18-transfected dim-VRCs. The graph shows the representative result of the measurement, which was performed in triplicate. ( D ) Relative quantification of CDH1 by qPCR. CDH1 levels were measured in proTGFβ transfected dim-VRCs 24 (proTGFβ – filled inverted triangles) or 48 h (proTGFβ – filled rhomboids) after transfection. The graph shows mean RQ 2 –ΔΔCT ± SEM relative to GAPDH. The results were normalized to the control, which was pUC18-transfected dim-VRCs 48 h after transfection. The graph shows the representative result of the measurement, which was performed in triplicate. dim-VRCs represented as circles, bright-VRCs represented as filled triangles. ( E ) Immunostaining of E-cadherin and ( F ) mCardinal fluorescence in VRCs and HT29 E-cadherin positive cells by flow cytometry. VRCs control—VRCs transfected with pUC18 vector; VRCs OVOL2—OVOL2-overexpressing cells 24 h after transfection. Immunostained untransfected HT29 cells were used as controls. The graph shows the single reads as well as the mean value of three independent experiments. Statistical significance in comparison to control group is represented by asterisks: * p ≤ 0.05; ** p ≤ 0.01; *** p ≤ 0.001. VRCs control represented as filled circles, VRCs OVOL2 represented as filled triangles, HT29 represented as filled inverted triangles.

Journal: Cells

Article Title: Genetically Engineered Lung Cancer Cells for Analyzing Epithelial–Mesenchymal Transition

doi: 10.3390/cells8121644

Figure Lengend Snippet: ( A ) mCardinal fluorescence of the dim-VRCs population transfected with active SNAI1 or proTGFβ plasmids. The fluorescence of the cells was measured after 24 h (control – filled circles, proTGFβ – filled squares, active SNAI1 – filled triangles) and 48 h (control – filled inverted triangles, proTGFβ – filled rhomboids, active SNAI1 – circles) of culture after sorting. The points correspond to the fluorescence of a selected ROI, whereas the lines show mean fluorescence. The fluorescence changes were considered statistically significant in comparison to the control group: * p ≤ 0.05 (Mann–Whitney test). ( B ) mCardinal and ( C ) VIM relative quantification (RQ) by qPCR. VIM and mCardinal genes were measured in transfected dim-VRCs 24 (proTGFβ – filled inverted triangles, active SNAI1 – filled squares) or 48 h (proTGFβ – filled rhomboids, active SNAI1 – filled circles) after transfection. dim-VRCs represented as circles, bright-VRCs represented as filled triangles. The data shows mean 2 –ΔΔCT relative to GAPDH. The results were normalized to the control, which was pUC18-transfected dim-VRCs. The graph shows the representative result of the measurement, which was performed in triplicate. ( D ) Relative quantification of CDH1 by qPCR. CDH1 levels were measured in proTGFβ transfected dim-VRCs 24 (proTGFβ – filled inverted triangles) or 48 h (proTGFβ – filled rhomboids) after transfection. The graph shows mean RQ 2 –ΔΔCT ± SEM relative to GAPDH. The results were normalized to the control, which was pUC18-transfected dim-VRCs 48 h after transfection. The graph shows the representative result of the measurement, which was performed in triplicate. dim-VRCs represented as circles, bright-VRCs represented as filled triangles. ( E ) Immunostaining of E-cadherin and ( F ) mCardinal fluorescence in VRCs and HT29 E-cadherin positive cells by flow cytometry. VRCs control—VRCs transfected with pUC18 vector; VRCs OVOL2—OVOL2-overexpressing cells 24 h after transfection. Immunostained untransfected HT29 cells were used as controls. The graph shows the single reads as well as the mean value of three independent experiments. Statistical significance in comparison to control group is represented by asterisks: * p ≤ 0.05; ** p ≤ 0.01; *** p ≤ 0.001. VRCs control represented as filled circles, VRCs OVOL2 represented as filled triangles, HT29 represented as filled inverted triangles.

Article Snippet: For functional experiments in H2170 knocked-in cells, we used (FLAG) Snail 6SA (active Snail) plasmid, which was a gift from Mien-Chie Hung (Addgene plasmid # 16221) [ ], TGFB1-bio-His (proTGFβ), which was a gift from Gavin Wright (Addgene plasmid # 52185) [ ], and HA-OVOL2 (OVOL2)-expressing plasmid, which was a gift from Changwon Park [ ].

Techniques: Fluorescence, Transfection, MANN-WHITNEY, Immunostaining, Flow Cytometry, Plasmid Preparation

( A – C ) Relative quantification of CDH1, ZEB1, and ZEB2 transcripts in transfected VRCs by qPCR. The expression of genes relative to GAPDH was measured 48 h after transfection of VRCs with OVOL2 (filled squares) and microRNA-expressing vectors ( miR-145 – filled inverted triangles, miR-200b – squares, miR-200c – triangles, and miR-205 – inverted triangles). The results were normalized to VRCs control – filled circles (mock transfected) and shown as mean RQ 2 –ΔΔCT as well as single values. The graph contains data from at least two independent experiments, which were measured in triplicate. Statistical significance in comparison to control was calculated using the Mann–Whitney test and was rated by asterisk: * p ≤ 0.05; ** p ≤ 0.01; *** p ≤ 0.001. ( D ) Real-time migration analysis of transfected VRCs using xCELLigence system. The line shows mean normalized cell index, whereas the colored area depicts the standard deviation of three replicates. Migration of VRCs transfected with OVOL2 is shown in green, miR-200c shown in blue, miR-205 shown in black, whereas pUC18, the control, is colored in red. The representative results from two different experiments are presented.

Journal: Cells

Article Title: Genetically Engineered Lung Cancer Cells for Analyzing Epithelial–Mesenchymal Transition

doi: 10.3390/cells8121644

Figure Lengend Snippet: ( A – C ) Relative quantification of CDH1, ZEB1, and ZEB2 transcripts in transfected VRCs by qPCR. The expression of genes relative to GAPDH was measured 48 h after transfection of VRCs with OVOL2 (filled squares) and microRNA-expressing vectors ( miR-145 – filled inverted triangles, miR-200b – squares, miR-200c – triangles, and miR-205 – inverted triangles). The results were normalized to VRCs control – filled circles (mock transfected) and shown as mean RQ 2 –ΔΔCT as well as single values. The graph contains data from at least two independent experiments, which were measured in triplicate. Statistical significance in comparison to control was calculated using the Mann–Whitney test and was rated by asterisk: * p ≤ 0.05; ** p ≤ 0.01; *** p ≤ 0.001. ( D ) Real-time migration analysis of transfected VRCs using xCELLigence system. The line shows mean normalized cell index, whereas the colored area depicts the standard deviation of three replicates. Migration of VRCs transfected with OVOL2 is shown in green, miR-200c shown in blue, miR-205 shown in black, whereas pUC18, the control, is colored in red. The representative results from two different experiments are presented.

Article Snippet: For functional experiments in H2170 knocked-in cells, we used (FLAG) Snail 6SA (active Snail) plasmid, which was a gift from Mien-Chie Hung (Addgene plasmid # 16221) [ ], TGFB1-bio-His (proTGFβ), which was a gift from Gavin Wright (Addgene plasmid # 52185) [ ], and HA-OVOL2 (OVOL2)-expressing plasmid, which was a gift from Changwon Park [ ].

Techniques: Transfection, Expressing, MANN-WHITNEY, Migration, Standard Deviation